ID: 1101737835_1101737842

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1101737835 1101737842
Species Human (GRCh38) Human (GRCh38)
Location 12:107476198-107476220 12:107476225-107476247
Sequence CCCTCCTGATGAGGCTTCCTGGG AGTGAAATGTCAGATGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 246} {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!