ID: 1101878627_1101878635

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1101878627 1101878635
Species Human (GRCh38) Human (GRCh38)
Location 12:108611427-108611449 12:108611469-108611491
Sequence CCACCAGATGCCCACGATCGTGA ACATGGCCAAATGTCCCCTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 19, 2: 216, 3: 594, 4: 1078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!