ID: 1101910461_1101910480

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1101910461 1101910480
Species Human (GRCh38) Human (GRCh38)
Location 12:108857338-108857360 12:108857379-108857401
Sequence CCCCCCTGCCCCGCACGCGCGGC GGCGCGGCGTCCGGCGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 349} {0: 1, 1: 0, 2: 2, 3: 31, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!