ID: 1101910467_1101910488

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1101910467 1101910488
Species Human (GRCh38) Human (GRCh38)
Location 12:108857347-108857369 12:108857399-108857421
Sequence CCCGCACGCGCGGCCCCAGCTCC AGGCCGGGCGCGGCGAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 464} {0: 1, 1: 1, 2: 2, 3: 26, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!