ID: 1102099954_1102099963

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102099954 1102099963
Species Human (GRCh38) Human (GRCh38)
Location 12:110270567-110270589 12:110270584-110270606
Sequence CCTCCACCAACACCCCCCCCCCT CCCCCTTTTTTTTTCTATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 286, 4: 2856} {0: 1, 1: 0, 2: 11, 3: 115, 4: 872}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!