ID: 1102099954_1102099968

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1102099954 1102099968
Species Human (GRCh38) Human (GRCh38)
Location 12:110270567-110270589 12:110270594-110270616
Sequence CCTCCACCAACACCCCCCCCCCT TTTTCTATTGTGGGACATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 286, 4: 2856} {0: 1, 1: 0, 2: 0, 3: 21, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!