|
Left Crispr |
Right Crispr |
| Crispr ID |
1102444418 |
1102444424 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:112990872-112990894
|
12:112990892-112990914
|
| Sequence |
CCTTCCCATCATGACCTGAGCTA |
CTAGTTTTTCAGGTTTCTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 102, 3: 184, 4: 344} |
{0: 22, 1: 42, 2: 124, 3: 404, 4: 1316} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|