ID: 1102554919_1102554926

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1102554919 1102554926
Species Human (GRCh38) Human (GRCh38)
Location 12:113720573-113720595 12:113720597-113720619
Sequence CCTGCAGCCTCCTCAGCCTTGGC CCAGCACCCTTAGAAGGAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!