ID: 1103031634_1103031637

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1103031634 1103031637
Species Human (GRCh38) Human (GRCh38)
Location 12:117619095-117619117 12:117619112-117619134
Sequence CCTTGAGAATTACTACAATGCTG ATGCTGTCTGCTAGATGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145} {0: 1, 1: 0, 2: 2, 3: 5, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!