ID: 1103035609_1103035613

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1103035609 1103035613
Species Human (GRCh38) Human (GRCh38)
Location 12:117654036-117654058 12:117654081-117654103
Sequence CCTGCCATCTTCTGCAGATAACT CTTGGCCTGTTACTAAGCTTTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 2, 1: 19, 2: 188, 3: 180, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!