|
Left Crispr |
Right Crispr |
Crispr ID |
1103035609 |
1103035614 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:117654036-117654058
|
12:117654084-117654106
|
Sequence |
CCTGCCATCTTCTGCAGATAACT |
GGCCTGTTACTAAGCTTTGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
{0: 2, 1: 18, 2: 158, 3: 154, 4: 151} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|