|
Left Crispr |
Right Crispr |
| Crispr ID |
1103045225 |
1103045236 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:117730501-117730523
|
12:117730543-117730565
|
| Sequence |
CCTTCCACGGTCTCCCTCTCCCT |
CTCCCTCTGATGCTGAGCCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 5, 2: 11, 3: 298, 4: 903} |
{0: 7, 1: 89, 2: 127, 3: 76, 4: 158} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|