ID: 1103045225_1103045239

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1103045225 1103045239
Species Human (GRCh38) Human (GRCh38)
Location 12:117730501-117730523 12:117730547-117730569
Sequence CCTTCCACGGTCTCCCTCTCCCT CTCTGATGCTGAGCCGAGGCTGG
Strand - +
Off-target summary {0: 11, 1: 5, 2: 11, 3: 298, 4: 903} {0: 7, 1: 122, 2: 611, 3: 679, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!