ID: 1103147541_1103147545

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1103147541 1103147545
Species Human (GRCh38) Human (GRCh38)
Location 12:118608784-118608806 12:118608797-118608819
Sequence CCAAATTTCCCTTCCTCCAGCTC CCTCCAGCTCTAGTGACTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!