ID: 1103183527_1103183546

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1103183527 1103183546
Species Human (GRCh38) Human (GRCh38)
Location 12:118936089-118936111 12:118936142-118936164
Sequence CCCCTCCTCGCTCCTTCCCCACC GGGGCAGGGGGCACAGCTACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 52, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!