ID: 1103183528_1103183544

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1103183528 1103183544
Species Human (GRCh38) Human (GRCh38)
Location 12:118936090-118936112 12:118936129-118936151
Sequence CCCTCCTCGCTCCTTCCCCACCT GATTATAGTTGTGGGGGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 25, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!