ID: 1103183534_1103183538

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103183534 1103183538
Species Human (GRCh38) Human (GRCh38)
Location 12:118936106-118936128 12:118936121-118936143
Sequence CCCACCTTGGCTTCTGTGTGCCA GTGTGCCAGATTATAGTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!