ID: 1103261466_1103261479

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1103261466 1103261479
Species Human (GRCh38) Human (GRCh38)
Location 12:119593039-119593061 12:119593090-119593112
Sequence CCCCAGGGGTCCTGCAGGTGGAA CACTGGGGAGGGCACCTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 273} {0: 1, 1: 0, 2: 3, 3: 30, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!