ID: 1103333121_1103333129

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1103333121 1103333129
Species Human (GRCh38) Human (GRCh38)
Location 12:120168598-120168620 12:120168629-120168651
Sequence CCTGCCCTTCCCTGACTGGGGCT TCACACTGGGCCATCCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 438} {0: 1, 1: 0, 2: 0, 3: 16, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!