ID: 1103393860_1103393868

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1103393860 1103393868
Species Human (GRCh38) Human (GRCh38)
Location 12:120593015-120593037 12:120593067-120593089
Sequence CCCTCATCAGTGGGATGAATGTG TGCCTTCTCTCCACCATGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 24, 3: 125, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!