ID: 1103779301_1103779322

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1103779301 1103779322
Species Human (GRCh38) Human (GRCh38)
Location 12:123388869-123388891 12:123388914-123388936
Sequence CCCGCCCGCCCTCCGGAGCGGCC CCCCTCCCCGGGCCGGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 284} {0: 1, 1: 0, 2: 10, 3: 75, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!