ID: 1103779311_1103779322

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1103779311 1103779322
Species Human (GRCh38) Human (GRCh38)
Location 12:123388900-123388922 12:123388914-123388936
Sequence CCGCCCCTACCAGCCCCCTCCCC CCCCTCCCCGGGCCGGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 33, 3: 436, 4: 2954} {0: 1, 1: 0, 2: 10, 3: 75, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!