ID: 1103779316_1103779337

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1103779316 1103779337
Species Human (GRCh38) Human (GRCh38)
Location 12:123388905-123388927 12:123388940-123388962
Sequence CCTACCAGCCCCCTCCCCGGGCC GTGGGCGGCTGCGAGCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 130, 4: 1156} {0: 1, 1: 0, 2: 1, 3: 32, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!