|
Left Crispr |
Right Crispr |
| Crispr ID |
1103816994 |
1103816997 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:123666311-123666333
|
12:123666338-123666360
|
| Sequence |
CCTTGTTGATTTTCTGTCTGGAT |
TGTCCAATGCTGAAAGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 12, 1: 90, 2: 321, 3: 3204, 4: 4865} |
{0: 2, 1: 7, 2: 11, 3: 31, 4: 171} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|