|
Left Crispr |
Right Crispr |
| Crispr ID |
1103872338 |
1103872345 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:124100806-124100828
|
12:124100842-124100864
|
| Sequence |
CCGGAGGGGTGGAAGTTAGTGGC |
CGGCAATCAGCAGTGGTGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 22, 2: 69, 3: 94, 4: 190} |
{0: 4, 1: 73, 2: 145, 3: 74, 4: 147} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|