ID: 1103926597_1103926603

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103926597 1103926603
Species Human (GRCh38) Human (GRCh38)
Location 12:124426848-124426870 12:124426863-124426885
Sequence CCGGCCGGCGCAGGGGACCCAGG GACCCAGGGAAGACACAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 252} {0: 1, 1: 0, 2: 3, 3: 55, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!