ID: 1103926600_1103926606

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1103926600 1103926606
Species Human (GRCh38) Human (GRCh38)
Location 12:124426852-124426874 12:124426867-124426889
Sequence CCGGCGCAGGGGACCCAGGGAAG CAGGGAAGACACAGAGGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 323} {0: 1, 1: 0, 2: 8, 3: 94, 4: 798}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!