ID: 1104203538_1104203551

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1104203538 1104203551
Species Human (GRCh38) Human (GRCh38)
Location 12:126615058-126615080 12:126615099-126615121
Sequence CCATTGAGAACATATCTCCCAAC CCCGCGATGAGCAAGGCGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!