ID: 1104392770_1104392779

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1104392770 1104392779
Species Human (GRCh38) Human (GRCh38)
Location 12:128405018-128405040 12:128405053-128405075
Sequence CCTGCTCTCCAGGCTGTCTCCCG ACCAGCATTGGACTTTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 278} {0: 1, 1: 0, 2: 0, 3: 14, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!