ID: 1104392770_1104392781

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1104392770 1104392781
Species Human (GRCh38) Human (GRCh38)
Location 12:128405018-128405040 12:128405054-128405076
Sequence CCTGCTCTCCAGGCTGTCTCCCG CCAGCATTGGACTTTTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 278} {0: 1, 1: 0, 2: 2, 3: 8, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!