ID: 1104813613_1104813619

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1104813613 1104813619
Species Human (GRCh38) Human (GRCh38)
Location 12:131633483-131633505 12:131633507-131633529
Sequence CCCACCTGCATCTCTTGGGGGGG CTCCAGGCATAGTTACCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 9, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!