ID: 1104911047_1104911056

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1104911047 1104911056
Species Human (GRCh38) Human (GRCh38)
Location 12:132241126-132241148 12:132241159-132241181
Sequence CCTTCCAGGGGCCCTCCCTATAC CACGCCACACCCCCTTCCCAGGG
Strand - +
Off-target summary {0: 5, 1: 37, 2: 11, 3: 17, 4: 150} {0: 1, 1: 29, 2: 12, 3: 40, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!