ID: 1104915568_1104915571

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1104915568 1104915571
Species Human (GRCh38) Human (GRCh38)
Location 12:132262682-132262704 12:132262700-132262722
Sequence CCATAGCTCATCTGTCTGCACCT CACCTGCAGGAGACACGGTTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 212} {0: 2, 1: 1, 2: 1, 3: 5, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!