ID: 1104915568_1104915578

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1104915568 1104915578
Species Human (GRCh38) Human (GRCh38)
Location 12:132262682-132262704 12:132262725-132262747
Sequence CCATAGCTCATCTGTCTGCACCT TGCGGTCAGGGCGCAGCATGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 212} {0: 2, 1: 1, 2: 1, 3: 11, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!