ID: 1105016880_1105016882

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1105016880 1105016882
Species Human (GRCh38) Human (GRCh38)
Location 12:132791578-132791600 12:132791601-132791623
Sequence CCAGGAAAGGACACATCTGCAGA GTTGTTACACTGAGGACTATAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 4, 3: 26, 4: 251} {0: 2, 1: 0, 2: 0, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!