ID: 1105039339_1105039347

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1105039339 1105039347
Species Human (GRCh38) Human (GRCh38)
Location 12:132949521-132949543 12:132949539-132949561
Sequence CCACCGGACTTTGGGTACCCTAC CCTACGGGTGGTGTTGAGGCTGG
Strand - +
Off-target summary {0: 10, 1: 11, 2: 17, 3: 15, 4: 48} {0: 16, 1: 26, 2: 15, 3: 10, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!