|
Left Crispr |
Right Crispr |
| Crispr ID |
1105213609 |
1105213615 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:18272124-18272146
|
13:18272159-18272181
|
| Sequence |
CCTTGGGAAGTCTCATGGCTATG |
AGGTGTGACAACAGGGAAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 4, 2: 4, 3: 15, 4: 224} |
{0: 7, 1: 0, 2: 0, 3: 62, 4: 352} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|