ID: 1105214178_1105214194

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1105214178 1105214194
Species Human (GRCh38) Human (GRCh38)
Location 13:18274702-18274724 13:18274751-18274773
Sequence CCATCCAGAAACATTAGCACCCC CAGAAAGGCAGGGCCCAGAGAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 6, 4: 128} {0: 4, 1: 0, 2: 7, 3: 64, 4: 688}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!