ID: 1105259864_1105259872

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1105259864 1105259872
Species Human (GRCh38) Human (GRCh38)
Location 13:18771012-18771034 13:18771053-18771075
Sequence CCAAGCTGTACCTGTGCATCTTT GAGCTGGAGCTGGAGCTGCAGGG
Strand - +
Off-target summary {0: 35, 1: 30, 2: 4, 3: 96, 4: 603} {0: 19, 1: 19, 2: 47, 3: 227, 4: 1074}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!