|
Left Crispr |
Right Crispr |
| Crispr ID |
1105262544 |
1105262553 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:18790335-18790357
|
13:18790383-18790405
|
| Sequence |
CCAAGCTGTACCTGTGCATCTTT |
AGCTGGAGCTGCAGGGATGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 35, 1: 30, 2: 4, 3: 96, 4: 603} |
{0: 25, 1: 47, 2: 177, 3: 665, 4: 1726} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|