|
Left Crispr |
Right Crispr |
| Crispr ID |
1105264465 |
1105264472 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:18803791-18803813
|
13:18803820-18803842
|
| Sequence |
CCAAGCTGTACCTGTGCATCTTT |
TGGCTGGTGCTGGAGCTGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 35, 1: 30, 2: 4, 3: 96, 4: 603} |
{0: 8, 1: 10, 2: 26, 3: 166, 4: 783} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|