ID: 1105334299_1105334300

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1105334299 1105334300
Species Human (GRCh38) Human (GRCh38)
Location 13:19450846-19450868 13:19450878-19450900
Sequence CCTCATAACACAATCTGGCAGGA AGATTTTCCTAAACCTAATATGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 15, 4: 167} {0: 2, 1: 0, 2: 2, 3: 15, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!