ID: 1105533452_1105533455

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1105533452 1105533455
Species Human (GRCh38) Human (GRCh38)
Location 13:21241938-21241960 13:21241961-21241983
Sequence CCATAATTTCTAATCAATGTAAC CTTCTATTATTCAGGAAAAAAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 17, 4: 230} {0: 2, 1: 0, 2: 2, 3: 23, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!