|
Left Crispr |
Right Crispr |
| Crispr ID |
1105740106 |
1105740111 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:23315149-23315171
|
13:23315188-23315210
|
| Sequence |
CCTGCCATCTTCTGAAGATAACT |
ACAACTCTTGGCCTGTTACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 197, 2: 186, 3: 120, 4: 255} |
{0: 17, 1: 184, 2: 186, 3: 148, 4: 230} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|