|
Left Crispr |
Right Crispr |
| Crispr ID |
1105740107 |
1105740110 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:23315153-23315175
|
13:23315187-23315209
|
| Sequence |
CCATCTTCTGAAGATAACTACTG |
GACAACTCTTGGCCTGTTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 208, 3: 231, 4: 555} |
{0: 17, 1: 171, 2: 183, 3: 131, 4: 176} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|