ID: 1105747199_1105747205

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1105747199 1105747205
Species Human (GRCh38) Human (GRCh38)
Location 13:23388676-23388698 13:23388716-23388738
Sequence CCATGGGTACACAAAAGCATACA CTGGAGACTCAGAAGCAGGGAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 7, 3: 43, 4: 205} {0: 4, 1: 15, 2: 51, 3: 169, 4: 627}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!