ID: 1105796254_1105796262

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1105796254 1105796262
Species Human (GRCh38) Human (GRCh38)
Location 13:23856483-23856505 13:23856509-23856531
Sequence CCACTGTTATTTAAATGCAAATT GGGTGGGTTAATGCAAATTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 198, 4: 730} {0: 8, 1: 12, 2: 24, 3: 40, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!