ID: 1105798695_1105798699

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1105798695 1105798699
Species Human (GRCh38) Human (GRCh38)
Location 13:23883772-23883794 13:23883805-23883827
Sequence CCTTTTCTGATTTCTGTGACACA CAGGGTATGAAACCTCCTTTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 39, 4: 364} {0: 2, 1: 0, 2: 0, 3: 17, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!