ID: 1105858715_1105858718

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1105858715 1105858718
Species Human (GRCh38) Human (GRCh38)
Location 13:24391777-24391799 13:24391792-24391814
Sequence CCTCGTGTGGGATGTCCTGAAGT CCTGAAGTCCAGGCCAGCCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 80} {0: 2, 1: 0, 2: 2, 3: 46, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!