|
Left Crispr |
Right Crispr |
Crispr ID |
1105920907 |
1105920912 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:24962523-24962545
|
13:24962545-24962567
|
Sequence |
CCAGCACTTCGGGAGGCCGAGGT |
TGGGCAGATCACCTGGCGTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 559, 1: 38189, 2: 180898, 3: 257200, 4: 189119} |
{0: 2, 1: 139, 2: 9151, 3: 29197, 4: 66070} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|